hdac3 flox  (Jackson Laboratory)

Journal: Cell & Bioscience

Article Title: Microglial HDAC3 inhibits the migration of CD8-positive T cell in the development of EAE by restraining the expression of CCL5

doi: 10.1186/s13578-026-01564-5

Figure Lengend Snippet: HDAC3 is upregulated in microglia of the spinal cord from EAE model mice. A , B The protein levels of HDAC3 and GAPDH in the spinal cord from ctrl ( n = 4) and EAE ( n = 4) mice were determined by western blot ( A ) and the gray values were analyzed by Image J ( B ). C , D The mRNA ( n = 6 for each group) and protein ( n = 3 for each group) levels of HDAC3 in primary microglia isolated from Ctrl and EAE mice were determined by real-time PCR ( C ) and western blot ( D ). E , F The protein levels of HDAC3 in Iba1 positive cells in the spinal cord from ctrl and EAE mice were determined by immunostaining ( E ) and the fluorescence intensity were quantified by Image J ( F ). G – I The protein levels of HDAC3 in CD11b + CD45 low cells in the spinal cord from ctrl ( n = 4) and EAE ( n = 4) mice were determined by flow cytometry ( G , H ) and the mean fluorescent intensity of HDAC3 in CD11b + CD45 low cells were analyzed ( I ) (*indicates p < 0.05, **indicates p < 0.01 by Student’s t -test)

Article Snippet: The Hdac3 flox/+ mice (Stock No: 024119) and Cx3cr1 creERT2−IRES−EYFP (also named Cx3cr1 creERT2 ) transgenic mice (Stock No: 021160) were purchased from the Jackson Laboratory (Sacramento, CA, USA) and have been used in our previous study [ ].

Techniques: Western Blot, Isolation, Real-time Polymerase Chain Reaction, Immunostaining, Fluorescence, Flow Cytometry

Journal: Cell & Bioscience

Article Title: Microglial HDAC3 inhibits the migration of CD8-positive T cell in the development of EAE by restraining the expression of CCL5

doi: 10.1186/s13578-026-01564-5

Figure Lengend Snippet: Mice with microglial Hdac3-deficiency exhibited higher sensitivity to EAE induction. A Spinal cord slices from WT and Hdac3 cKO mice were stained with anti-HDAC3 (red) and anti-Iba1 (green) antibody, and the yellow arrow pointed to the signal of HDAC3 responding to the position of the Iba1-positive area. B The protein levels of HDAC3 and GAPDH in the primary microglia isolated from WT ( n = 3) and Hdac3 cKO ( n = 3) mice were determined by western blot and the gray values were analyzed by Image J. C Clinical score of WT EAE ( n = 8) and Hdac3 cKO EAE ( n = 8) mice were recorded every day post-immunization. D , E Spinal cord slices from WT EAE ( n = 6) and Hdac3 cKO EAE ( n = 6) mice were stained with Fast-blue and eosin ( D ), and the percentage of the Fast-blue negative area ( E ) was analyzed by ImageJ. F Spinal cord slices from WT EAE and Hdac3 cKO EAE mice were stained with anti-MBP antibody. G , H Spinal cord slices from WT EAE ( n = 7) and Hdac3 cKO EAE ( n = 7) mice were stained with H/E staining ( G ), and the number of infiltrated cells was counted manually ( H ). (*indicates p < 0.05, **indicates p < 0.01 by ANOVA or Student’s t -test)

Article Snippet: The Hdac3 flox/+ mice (Stock No: 024119) and Cx3cr1 creERT2−IRES−EYFP (also named Cx3cr1 creERT2 ) transgenic mice (Stock No: 021160) were purchased from the Jackson Laboratory (Sacramento, CA, USA) and have been used in our previous study [ ].

Techniques: Staining, Isolation, Western Blot

Journal: Cell & Bioscience

Article Title: Microglial HDAC3 inhibits the migration of CD8-positive T cell in the development of EAE by restraining the expression of CCL5

doi: 10.1186/s13578-026-01564-5

Figure Lengend Snippet: Microglial Hdac3-deficiency promoted periphery immune infiltration in the spinal cord during EAE development. A , B Kyoto encyclopedia of genes and genomes (KEGG) analysis ( A ) and ImmunoSystemProcess analysis ( B ) of the different expressed genes (DEGs) between the spinal cord from WT EAE mice and Hdac3 cKO EAE mice in RNA-sequencing data were performed by Cytoscape. C The mRNA levels of marker genes for T cell, B cell, NK cell and granulocyte in RNA-sequencing data from WT EAE mice and Hdac3 cKO EAE mice were displayed as heatmap. D , E Gene set enrichment analysis (GSEA) showed that the TCR signaling pathway ( D ) and positive regulation of leukocyte migration ( E ) were upregulated in the spinal cord from Hdac3 cKO EAE mice. F , G Genes involved in the TCR signaling pathway ( F ) and positive regulation of leukocyte migration ( G ) were upregulated in the spinal cord from Hdac3 cKO EAE mice ( N = 3 for each group)

Article Snippet: The Hdac3 flox/+ mice (Stock No: 024119) and Cx3cr1 creERT2−IRES−EYFP (also named Cx3cr1 creERT2 ) transgenic mice (Stock No: 021160) were purchased from the Jackson Laboratory (Sacramento, CA, USA) and have been used in our previous study [ ].

Techniques: RNA Sequencing, Marker, Migration

Journal: Cell & Bioscience

Article Title: Microglial HDAC3 inhibits the migration of CD8-positive T cell in the development of EAE by restraining the expression of CCL5

doi: 10.1186/s13578-026-01564-5

Figure Lengend Snippet: Inhibition of HDAC3 increased CD8 + T cell infiltration in spinal cord during EAE development. A – C The mRNA levels of CD3g ( A ), CD8a ( B ) and FasL ( C ) in the spinal cord from WT Ctrl ( n = 4), EAE mice administrated with RGFP966 ( n = 5) or vehicle ( n = 5) were determined by real-time PCR. D – F The mRNA levels of CD3g ( D ), CD8a ( E ) and FasL ( F ) in the spinal cord from WT Ctrl ( n = 6), WT EAE ( n = 6) and Hdac3 cKO EAE ( n = 6) mice were determined by real-time PCR. G – I The number of CD8 + T cell in the spinal cord from WT Ctrl, EAE mice administered with RGFP966 ( n = 6) or vehicle ( n = 6) ( G , H ), and WT EAE ( n = 5) and Hdac3 cKO EAE ( n = 5) mice ( G and I ) were detected by immunostaining with anti-CD8a and the number of CD8a-positive cells were counted. J , K The percentage of CD8 + T cells (gated in CD8a and CD3e double positive) in the spinal cord from WT Ctrl ( n = 6), WT EAE ( n = 6) and Hdac3 cKO EAE ( n = 6) mice were analyzed by flow cytometry with antibodies against CD8a and CD3e. (*indicates p < 0.05, **indicates p < 0.01 by ANOVA or Student’s t -test)

Article Snippet: The Hdac3 flox/+ mice (Stock No: 024119) and Cx3cr1 creERT2−IRES−EYFP (also named Cx3cr1 creERT2 ) transgenic mice (Stock No: 021160) were purchased from the Jackson Laboratory (Sacramento, CA, USA) and have been used in our previous study [ ].

Techniques: Inhibition, Real-time Polymerase Chain Reaction, Immunostaining, Flow Cytometry

Journal: Cell & Bioscience

Article Title: Microglial HDAC3 inhibits the migration of CD8-positive T cell in the development of EAE by restraining the expression of CCL5

doi: 10.1186/s13578-026-01564-5

Figure Lengend Snippet: Inhibition of HDAC3 increased the expression of CCL5 in spinal cord during EAE development. A Scatter diagram of the fold_change and p _value of the mRNA levels of chemokines between WT and Hdac3 cKO primary microglia analyzed by RNA-sequencing. B The chemokines that upregulated in Hdac3 cKO EAE spinal cord and Hdac3 cKO primary microglia were analyzed by RNA-sequencing. C , D The mRNA levels of CCL5 in the spinal cord from Ctrl ( n = 4), EAE mice administered with RGFP966 ( n = 7) or vehicle ( n = 5) ( C ), and WT_EAE ( n = 6) and Hdac3 cKO_EAE ( n = 6) mice ( D ) were determined by real-time PCR. E , F The mRNA levels of CCL5 ( E ) and HDAC3 ( F ) in WT ( n = 3) and Hdac3 cKO ( n = 3) primary microglia were determined by real-time PCR. G – I The protein levels of CCL5 and Iba1 in the spinal cord from Ctrl, EAE mice administrated with RGFP966 ( n = 6) or vehicle ( n = 6) ( G , H ), and WT_EAE ( n = 6) and Hdac3 cKO_EAE ( n = 6) mice ( G and I ) were detected by immunostaining with anti-CCL5 and anti-Iba1 antibodies and the number of CCL5 + Iba1 + cells were counted. (*indicates p < 0.05, **indicates p < 0.01 by ANOVA or Student’s t -test)

Article Snippet: The Hdac3 flox/+ mice (Stock No: 024119) and Cx3cr1 creERT2−IRES−EYFP (also named Cx3cr1 creERT2 ) transgenic mice (Stock No: 021160) were purchased from the Jackson Laboratory (Sacramento, CA, USA) and have been used in our previous study [ ].

Techniques: Inhibition, Expressing, RNA Sequencing, Real-time Polymerase Chain Reaction, Immunostaining

Journal: Cell & Bioscience

Article Title: Microglial HDAC3 inhibits the migration of CD8-positive T cell in the development of EAE by restraining the expression of CCL5

doi: 10.1186/s13578-026-01564-5

Figure Lengend Snippet: Microglial HDAC3 restrains IFN-γ induced expression of CCL5 by deacetylating on histone 3 lysine 9. A , B The mRNA levels ( A ) and protein levels ( B ) of HDAC3 and β-actin in N9 cells transfected with siRNA against HDAC3 (siHDAC3) or negative control (siNC) were determined by real-time PCR 72 h post-transfection. C , D N9 cells were pretreated with siRNA ( C ) or RGFP966 ( D ) as above, and then were stimulated with rIFN-γ (10 ng/ml) for indicating hours, and the cells were collected for detecting the mRNA levels of CCL5 by real-time PCR. E , F N9 cells were pretreated with siRNA ( E ) or RGFP966 ( F ) as above, and then were stimulated with rIFN-γ (10 ng/ml) for 24 h, and the protein levels of CCL5 in the supernatants were determined by ELISA. G N9 cells were pretreated with DMSO or RGFP966 (10 µM) for 12 h, then the cells were stimulated with rIFN-γ for indicating hours, and the protein levels of CCL5 in the supernatant and the protein levels of GAPDH in cells were determined via western blot. H Primary microglia were pretreated with RGFP966 for 12 h, and then were stimulated with rIFN-γ for 24 h, and the concentrations of CCL5 in the supernatant were determined by ELISA. I - J Migrated CD8 + T cells induced by conditional medium from primary microglia treated with rIFN-γ plus siRNA ( I ) or rIFN-γ plus RGFP966 ( J ) were analyzed by cell counting. K , L Migrated CD8 + T cells induced by conditional medium from N9 cells treated with rIFN-γ plus siRNA ( K ) or rIFN-γ plus RGFP966 ( L ) with or without CCL5 neutralization antibody were analyzed by cell counting. M The acetylation levels at H3K9 on the promoter of Ccl5 were determined by chromosome immunoprecipitation plus real-time PCR. M The model that HDAC3 regulates the expression of CCL5 by histone deacetylation. (* indicates p < 0.05, **indicates p < 0.01 by ANOVA or Student’s t -test)

Article Snippet: The Hdac3 flox/+ mice (Stock No: 024119) and Cx3cr1 creERT2−IRES−EYFP (also named Cx3cr1 creERT2 ) transgenic mice (Stock No: 021160) were purchased from the Jackson Laboratory (Sacramento, CA, USA) and have been used in our previous study [ ].

Techniques: Expressing, Transfection, Negative Control, Real-time Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay, Western Blot, Cell Counting, Neutralization, Immunoprecipitation

Journal: Cell & Bioscience

Article Title: Microglial HDAC3 inhibits the migration of CD8-positive T cell in the development of EAE by restraining the expression of CCL5

doi: 10.1186/s13578-026-01564-5

Figure Lengend Snippet: Anti-CD8 neutralizing antibody could attenuate the symptoms of Hdac3 cKO EAE mice. A Clinical score of Hdac3 cKO_EAE mice injected with anti-CD8 NAb ( n = 7) or isotype IgG ( n = 7) every other day, and WT_EAE ( n = 7) mice injected with isotype IgG were recorded every day post immunization. B , C Spinal cord slices from Hdac3 cKO_EAE mice injected with anti-CD8 NAb ( n = 6) or isotype IgG ( n = 6) every other day, and WT_EAE ( n = 6) mice injected with isotype IgG were stained with Fast-blue and eosin ( B ), and the percentage of the Fast-blue negative area ( C ) was analyzed by ImageJ. D , E Spinal cord slices from Hdac3 cKO_EAE mice injected with anti-CD8 NAb ( n = 6) or isotype IgG ( n = 6) every other day, and WT_EAE ( n = 7) mice injected with isotype IgG were stained with anti-MBP antibody and the percentage of the Fast-blue negative area was analyzed by ImageJ. F Proposed mechanism: microglial HDAC3 restrained IFN-γ-induced expression of CCL5 via deacetylation of H3K9 on the promoter of Ccl5 ; inhibition of HDAC3 resulted in upregulation of CCL5 in microglia, which promoted the migration of CD8 + T cells to the spinal cord to accelerate the development of EAE

Article Snippet: The Hdac3 flox/+ mice (Stock No: 024119) and Cx3cr1 creERT2−IRES−EYFP (also named Cx3cr1 creERT2 ) transgenic mice (Stock No: 021160) were purchased from the Jackson Laboratory (Sacramento, CA, USA) and have been used in our previous study [ ].

Techniques: Injection, Staining, Expressing, Inhibition, Migration

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: HDAC3 Preserves the primordial follicle reserve by epigenetically suppressing ferroptosis in pregranulosa cells

doi: 10.1007/s00018-026-06128-x

Figure Lengend Snippet: HDAC3 played an important role in PFs maintenance. a , b HDAC3 (green) kept a stable expression level in pGCs before puberty and in adulthood. Nuclei were dyed with Hoechst (blue). PFs were framed by the yellow dashed line, pGCs were framed by white dashed line. Scale bar = 40 μm. n = 3 biologically independent experiments. a Germ cells were dyed with MVH (rad). b GCs were dyed with FOXL2 (red). c , e Pan-acetylation levels of ovarian proteins were significantly upregulated after the inhibition of HDAC3 in vitro. RGFP and SC were the two specific inhibitors of HDAC3. n = 3. Data are presented as mean ± SD. Asterisks (*) indicate significant differences at ** P <0.01. d Ovarian volume unchanged after inhibition of HDAC3 in 2 dpp ovaries cultured for 1 day, but ovarian volume was decreased after inhibition of HDAC3 in 2 dpp ovaries cultured for 5 days. Scale bar = 40 μm. n ≥ 3. f The number of PFs was decreased in a time-dependent manner by inhibiting HDAC3. n ≥ 3. Data are presented as mean ± SD. Asterisks (*) indicate significant differences at ** P <0.01. g The number of total follicles was decreased in a time-dependent manner by inhibiting HDAC3. n ≥ 3. Data are presented as mean ± SD. Asterisks (*) indicate significant differences at ** P <0.01

Article Snippet: Hdac3 flox/flox mice were purchased from the Jackson Laboratory (ME, USA), and Foxl2-CreER T2 mice were gifted by Prof. Kui Liu.

Techniques: Expressing, Inhibition, In Vitro, Cell Culture

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: HDAC3 Preserves the primordial follicle reserve by epigenetically suppressing ferroptosis in pregranulosa cells

doi: 10.1007/s00018-026-06128-x

Figure Lengend Snippet: Deficiency of Hdac3 in GCs resulted in decreased follicle number. a Schematic representation of the deletion of Hdac3 exon 4–7 in GCs was induced by tamoxifen injection at 1dpp, 3 dpp and 5 dpp. b HDAC3 levels in 10-dpp-old Hdac3 f/f and Hdac3 cKO ovaries were quantified by Western blotting analysis. n = 3 biologically independent experiments. c HDAC3 (green) were decreased in ovaries from 10-dpp-old Hdac3 cKO mice. Nuclei were dyed with Hoechst (blue). GCs were dyed with FOXL2 (red). Scale bar = 40 μm. n = 3 biologically independent experiments. d , e Comparison of follicle numbers of Hdac3 f/f and Hdac3 cKO mice at 10 dpp ( n = 4, p = 0.4972 for PFs, p = 0.8286 for PaFs, p = 0.3672 for SFs, p = 0.5039 for total follicles). Scale bar = 40 μm. f HDAC3 (green) were decreased in ovaries from 10-dpp-old Hdac3 cKO mice. Nuclei were dyed with Hoechst (blue). Scale bar = 40 μm. n = 3 biologically independent experiments. g , h Comparison of follicle numbers of Hdac3 f/f and Hdac3 cKO mice at 2 w ( n = 3, p = 0.0031 for PFs, p = 0.0134 for PaFs, p = 0.0002 for SFs, p = 0.0031 for total follicles). Scale bar = 40 μm. i HDAC3 (green) were decreased in ovaries from 2-week-old Hdac3 cKO mice. Nuclei were dyed with Hoechst (blue). Scale bar = 40 μm. n = 3. j , k Comparison of follicle numbers of Hdac3 f/f and Hdac3 cKO mice at 3 w ( n = 3, p = 0.0182 for PFs, p = 0.0222 for PaFs, p = 0.0242 for SFs, p = 0.0133 for total follicles). Scale bar = 40 μm. l HDAC3 (green) were decreased in ovaries from 3-week-old Hdac3 cKO mice. Nuclei were dyed with Hoechst (blue). Scale bar = 40 μm. n = 3

Article Snippet: Hdac3 flox/flox mice were purchased from the Jackson Laboratory (ME, USA), and Foxl2-CreER T2 mice were gifted by Prof. Kui Liu.

Techniques: Injection, Western Blot, Comparison

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: HDAC3 Preserves the primordial follicle reserve by epigenetically suppressing ferroptosis in pregranulosa cells

doi: 10.1007/s00018-026-06128-x

Figure Lengend Snippet: The inhibition of HDAC3 did not affect PF activation. a , b Representative images showed that the translocation of FOXO3a (green) from the nucleus to the cytoplasm (white arrows) was not facilitated after inhibition of HDAC3 by RGFP in 2 dpp ovaries cultured for 1 day. n = 5. Nuclei were dyed with Hoechst (blue). GCs were dyed with FOXL2 (rad). Data are presented as mean ± SD. Scale bar = 40 μm. c , d Representative images showed that the translocation of FOXO3a (green) from the nucleus to the cytoplasm (white arrows) was not facilitated after inhibiting HDAC3 (RGFP) in 2 dpp ovaries cultured for 2 days. n = 6 biologically independent experiments. Nuclei were dyed with Hoechst (blue). GCs were dyed with FOXL2 (rad). Data are presented as mean ± SD. Scale bar = 40 μm. e Western blotting analysis showed that the inhabitation of HDAC3 had no effects on the protein levels of molecules related to PF activation

Article Snippet: Hdac3 flox/flox mice were purchased from the Jackson Laboratory (ME, USA), and Foxl2-CreER T2 mice were gifted by Prof. Kui Liu.

Techniques: Inhibition, Activation Assay, Translocation Assay, Cell Culture, Western Blot

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: HDAC3 Preserves the primordial follicle reserve by epigenetically suppressing ferroptosis in pregranulosa cells

doi: 10.1007/s00018-026-06128-x

Figure Lengend Snippet: Inhibition of HDAC3 caused ferroptosis in cultured ovaries in vitro . a , b Lipid ROS in ovarian cells after RGFP treatment. Scale bar = 40 μm. n ≥ 3. Data are presented as mean ± SD. Asterisks (*) indicate significant differences at *** P < 0.001. c , d Representative images showing that ACSL4 (green) in control and HDAC3 inhibited ovaries. The level of ACSL4 was increased in ovaries after RGFP treatment, pGCs were framed by white dashed line. Scale bar = 40 μm. n = 3, *** P value<0.0001. e TEM of PFs in control and HDAC3 inhibited ovaries. Mitochondrial volume was decreased after the inhibiting of HDAC3 in 2 dpp ovaries cultured for 2 days. Scale bar = 40 μm. n = 3. f Western bolting assay showed that the expression levels of ferroptosis related proteins ACSL4 were increased after the inhibition of HDAC3 in 2 dpp ovaries cultured for 1 day. n = 3. g RNA-seq analysis revealed the transcriptional levels of Tfr2 were increased after HDAC3 inhibited (as indicated by the Log10(FPKM) of the RGFP group compared with that of the control group). n = 3, p value<0.001. h Ovarian volume was rescued after inhibiting of HDAC3 while inhibiting ferroptosis in 2 dpc ovaries cultured for 5 days. Scale bar = 40 μm. n ≥ 3. i The number of ovarian follicles was rescued by inhibiting HDAC3 while inhibition of ferroptosis in 2 dpc ovaries cultured for 5 days. n ≥ 3. Data are presented as mean ± SD. Asterisks (*) indicate significant differences at ** P <0.01. j Western bolting assay showed that the levels of ferroptosis related proteins ACSL4 were similar to control group after the inhibiting of HDAC3 while the inhibiting of ferroptosis in 2 dpp ovaries cultured for 5 days. n = 3. k , l Lipid ROS in ovarian cells after Erastin treatment. Scale bar = 40 μm. Data are presented as mean ± SD. n = 3, p value<0.0001. m Ovarian volume was decreased after activating of ferroptosis in 2 dpp ovaries cultured for 5 days. Scale bar = 40 μm. n ≥ 3. n The number of ovarian follicles was rescued by activating ferroptosis in 2 dpp ovaries cultured for 5 days. n ≥ 3. Data are presented as mean ± SD. Asterisks (*) indicate significant differences at ** P <0.01, *** P < 0.001

Article Snippet: Hdac3 flox/flox mice were purchased from the Jackson Laboratory (ME, USA), and Foxl2-CreER T2 mice were gifted by Prof. Kui Liu.

Techniques: Inhibition, Cell Culture, In Vitro, Control, Western Blot, Expressing, RNA Sequencing

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: HDAC3 Preserves the primordial follicle reserve by epigenetically suppressing ferroptosis in pregranulosa cells

doi: 10.1007/s00018-026-06128-x

Figure Lengend Snippet: Inhibition of HDAC3 affected the expression of ferroptosis-related genes and iron homeostasis. a Heatmap showing the expression patterns of certain ferroptosis-related genes. b Total iron in GCs from the control and the HDAC3 inhibited ovaries (2 dpp + 1 day). c n(Fe 2+ )/n(Fe) in GCs from the control and the HDAC3 inhibited ovaries (2 dpp + 1 day). d Relative content of ferrous iron of cytoplasm and mitochondria in GCs from the control and the HDAC3 inhibited ovaries (2 dpp + 1 day). e-h Western blotting analysis of TFR2, FDXR, GOT1 and FUNDC2 in GCs from the control and the HDAC3 inhibited ovaries (2 dpp + 1 day). i Western blotting analysis of TF in the control and the HDAC3 inhibited ovaries (2 dpp + 1 day). j Western blot analysis to identify the separate effect of cytoplasmic and mitochondrial. k-o Statistical analysis of difference in protein levels of TFR2, FDXR, GOT1, FUNDC2 and TF. p-t Statistical analysis of difference in RNA levels of TFR2, FDXR, GOT1, FUNDC2 and TF. Total proteins and RNA values were compared to the control, which was normalized to 1.0. Data were presented as mean ± SEM, n ≥ 3. ‘’ns’’ indicates not significant ( P > 0.05), whereas the asterisks (*) indicate significant differences at ** P < 0.01, *** P < 0.001

Article Snippet: Hdac3 flox/flox mice were purchased from the Jackson Laboratory (ME, USA), and Foxl2-CreER T2 mice were gifted by Prof. Kui Liu.

Techniques: Inhibition, Expressing, Control, Western Blot

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: HDAC3 Preserves the primordial follicle reserve by epigenetically suppressing ferroptosis in pregranulosa cells

doi: 10.1007/s00018-026-06128-x

Figure Lengend Snippet: HDAC3 deficiency impaired levels of proteins involved in iron metabolism and ISCs in GCs. a-h Western blotting analysis of p53, p21, p16, IRP1, IRP2, FTMT, NDUFS1, SDHB and UQCRFS1 in GCs from 10-dpp-old Hdac3 f/f and Hdac3 cKO ovaries. i-q Statistical analysis of difference in protein levels of p53, p21, p16, IRP1, IRP2, FTMT, NDUFS1, SDHB and UQCRFS1. Total proteins values were compared to the control, which was normalized to 1.0. Data were presented as mean ± SEM, n ≥ 3. ‘’ns’’ indicates not significant ( P > 0.05), whereas the asterisks (*) indicate significant differences at * P < 0.05, ** P < 0.01, *** P < 0.001

Article Snippet: Hdac3 flox/flox mice were purchased from the Jackson Laboratory (ME, USA), and Foxl2-CreER T2 mice were gifted by Prof. Kui Liu.

Techniques: Western Blot, Control

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: HDAC3 Preserves the primordial follicle reserve by epigenetically suppressing ferroptosis in pregranulosa cells

doi: 10.1007/s00018-026-06128-x

Figure Lengend Snippet: H3K27ac affected the transcriptional activity of ferroptosis-related genes. a , c The expression level of H3K27ac was increased, but the expression level of H3K4ac, H3K9ac, H3K14ac, H3K18ac and H3K23ac were not changed in 2 dpp ovaries cultured with the inhibitor of HDAC3 for 1 day. n = 3. b The level of H3K27ac was increased, but the level of H3K9ac was not changed in Hdac3 cKO mice, n = 1. d The level of HDAC3 was decreased in Hdac3 cKO mice, n = 1. e Distribution of H3K27ac binding sites in the TSS region, with horizontal coordinates indicating the relative position of reads to the TSS and vertical coordinates indicating the coverage depth. f Distribution characteristics of H3K27ac binding sites. g Distribution of H3K27ac on ferroptosis-related genes and nearby cis-regulatory elements. h ChIP-qPCR analysis of the enrichment of H3K27ac in the promoter region of ferroptosis-related genes in GCs from 10-dpp-old C57B6/J mice. qPCR data were processed using the Livak method, and the values were normalised to show the multiplicity of enrichment. Data were presented as mean ± SEM, n ≥ 3. Asterisks (*) indicate significant differences at ** P < 0.01, *** P < 0.001

Article Snippet: Hdac3 flox/flox mice were purchased from the Jackson Laboratory (ME, USA), and Foxl2-CreER T2 mice were gifted by Prof. Kui Liu.

Techniques: Activity Assay, Expressing, Cell Culture, Binding Assay, ChIP-qPCR

Journal: Science Advances

Article Title: Arresting the bad seed: HDAC3 regulates proliferation of different microglia after ischemic stroke

doi: 10.1126/sciadv.ade6900

Figure Lengend Snippet: ( A ) Flow cytometry gating strategy for microglia (CD45 int CD11b + ), macrophages (CD45 + CD11b + F4/80 + ), neutrophils (CD45 + CD11b + F4/80 − ), oligodendrocytes (CD45 − CD11b − O4 + ), and the other cells (CD45 − CD11b − O4 − ). ( B ) Representative flow cytometry plot showing HDAC3 level in microglia, macrophages, oligodendrocytes, neutrophil, and O4 − other cells. ( C ) Mean fluorescence intensity (MFI) of HDAC3 in different cells by flow cytometry. n = 4 per group. IL, ipsilesional; CL, contralateral. ( D ) Schematic depicting where the Iba1/HDAC3 immunofluorescence images were taken from in the peri-infarct region of CTX and STR 3 days after tFCI for representation and quantification. Representative images demonstrating the location of HDAC3 in microglia [three dimensional (3D) reconstruction was performed on the cell indicated by white boxes] and the increase of HDAC3 number and MFI in microglia after tFCI (HDAC3 + Iba1 + , white arrows). n = 5 per group. ( E ) Diagram illustrating the strategy for microglia-specific knockout of HDAC3. ( F ) Gating strategy of flow sorting for microglia (CD45 int CD11b + ) and other brain cells (CD45 − CD11b − ) in brain (top left) or macrophages (Ly6G − CD11C − CD45 + CD11b + ) in blood (bottom left). Representative flow plot showing CX3CR1 Cre -eYFP fluorescence intensity in the brain (top right) or in blood (bottom right). ( G ) Quantification of HDAC3 mRNA detected by quantitative reverse transcription polymerase chain reaction (qRT-PCR) at 30 days after tamoxifen treatment on FACS-sorted cells to verify the deletion of HDAC3 in microglia. n = 5 to 6 per group. All data are presented as means ± SEM. Data were analyzed using unpaired two-tailed Student’s t test or Mann-Whitney test (C, Oligodendrocytes panel). * P < 0.05 and *** P < 0.001; ns, no significance.

Article Snippet: HDAC3 flox/flox mice were constructed by Shanghai Model Organisms Center.

Techniques: Flow Cytometry, Fluorescence, Immunofluorescence, Knock-Out, Reverse Transcription, Polymerase Chain Reaction, Quantitative RT-PCR, Two Tailed Test, MANN-WHITNEY

Journal: Science Advances

Article Title: Arresting the bad seed: HDAC3 regulates proliferation of different microglia after ischemic stroke

doi: 10.1126/sciadv.ade6900

Figure Lengend Snippet: ( A ) Flow-sorted CD11b + CD45 int (microglia) cell population 3 days after tFCI for RNA-seq. n = 3 biological replicates (each includes three to four mice) per group. ( B ) PCA plot. ( C ) Differential expression analysis revealed microglia-specific transcriptional changes in response to tFCI and HDAC3-miKO after tFCI. ( D ) Proinflammatory or anti-inflammatory expression profile. Each column represents a sample. Data were presented as z score, representing the expression levels normalized to the mean and SD of each gene (row). ( E ) mRNA expression of proinflammatory factors and inflammatory factors for FACS-purified microglia 3 days after tFCI. Data were shown as fold change of WT-tFCI. n = 3 per group (qRT-PCR validation). ( F ) GSEA using Reactome pathway suggested the role of microglial HDAC3 in response to tFCI (miKO-tFCI versus WT-tFCI). ( G ) Venn plot showed 97, 36, or 127 terms produced by GSEA analysis ( P adj < 0.12) of genes generated by the comparison WT-tFCI versus WT-Sham, miKO-tFCI versus WT-tFCI, or miKO-tFCI versus miKO-Sham ( P adj < 0.05), respectively. The overlap referred to terms that gained normalized enrichment score (NES) of different directions in the aforementioned comparison, including six terms all related to mitosis (bar plot). ( H ) Heatmap showed expression of proliferation-related genes in microglia, while the most prominently affected genes ( Cenpf , Kntc1 , Mki67 , and Ccnb2 ) were depicted through bar plots for enhanced visualization ( I ). ( J ) qRT-PCR validated mRNA expression levels of representative genes involved in different cell cycle phases in FACS-purified microglia 3 days after tFCI. Data were shown as fold change of WT-tFCI controls. n = 3 per group. All data are presented as means ± SEM. Data were analyzed using unpaired two-tailed Student’s t test (E and J) or differential expression analysis via DEseq2 (I). * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: HDAC3 flox/flox mice were constructed by Shanghai Model Organisms Center.

Techniques: RNA Sequencing, Quantitative Proteomics, Expressing, Purification, Quantitative RT-PCR, Biomarker Discovery, Produced, Generated, Comparison, Two Tailed Test

Journal: Science Advances

Article Title: Arresting the bad seed: HDAC3 regulates proliferation of different microglia after ischemic stroke

doi: 10.1126/sciadv.ade6900

Figure Lengend Snippet: ( A ) PCA showed the separation of ATAC-seq signals of all samples by group. Volcano plots showed the microglia-specific DARs (log 2 FC >0.5 or <−0.5, FDR < 0.01) in poststroke/Sham-operated brains from HDAC3-miKO and WT mice. ( B ) Enrichment map visualizing enriched Reactome pathways obtained from GSEA of all annotated DARs (FDR < 0.01) from miKO-tFCI versus WT-tFCI. Mutually overlapping terms clustered together. The red circle indicated the clustered cell cycle–related terms of interest. ( C ) Permutation test showing the overlap of DEGs between region sets generated from RNA-seq and ATAC-seq. ( D ) IGV map tracks showing ATAC-seq and RNA-seq signals at Spi1 loci. ( E ) Homer de novo motif analysis of closed DARs at promoters (<3 kb to TSS) in miKO-tFCI versus WT-tFCI. ( F ) RNA-seq revealed transcriptional expression of transcriptional factors indicated above in four groups. ** P < 0.01, *** P < 0.001 (miKO-tFCI versus WT-tFCI, differential expression analysis via DEseq2). ( G ) qRT-PCR–validated mRNA expression levels of PU.1 for FACS-purified microglia 3 days after tFCI. Data are shown as fold change of WT-tFCI controls. n = 3 per group. ( H ) Double-labeled immunofluorescence of Iba1/PU.1 in the peri-infarct region of striatum 3 days after tFCI. ( I ) MFI of PU.1 in Iba1 + cells in the peri-infarct region of STR 3 days after tFCI. n = 6 per group. ( J ) Gating strategy for microglia (CD45 int CD11b + ) and the MFI of PU.1 in microglia. ( K ) MFI of PU.1 for microglia in the brain by flow cytometry. n = 5 to 6 per group. All data are presented as means ± SEM. Data were analyzed using one-way ANOVA followed by Bonferroni’s post hoc test (I) or unpaired two-tailed Student’s t test (G and K). ** P < 0.01. * P < 0.05, *** P < 0.001.

Article Snippet: HDAC3 flox/flox mice were constructed by Shanghai Model Organisms Center.

Techniques: Generated, RNA Sequencing, Expressing, Quantitative Proteomics, Quantitative RT-PCR, Purification, Labeling, Immunofluorescence, Flow Cytometry, Two Tailed Test

Journal: Clinical Epigenetics

Article Title: Histone deacetylase 3 deletion in alveolar type 2 epithelial cells prevents bleomycin-induced pulmonary fibrosis

doi: 10.1186/s13148-023-01588-5

Figure Lengend Snippet: IPF is characterized by increased HDAC3 expression in human lung tissues and AT2. A Histological analyses showing masson staining and representative images showing immunohistochemical staining of HDAC3 in healthy controls and patients with IPF (× 200, n = 6). B HDAC3 mRNA quantification in patients with IPF vs healthy controls (n = 6). C Representative Western blot images and the corresponding quantitative results for HDAC3 in patients with IPF vs healthy controls (n = 6). D HDAC3 activity in lung tissues from patients with IPF vs healthy controls (n = 6). E Bioinformatics analysis of HDAC3 expression in AT2 cells from patients with IPF vs healthy controls ( F ). Representative images of HDAC3 and ABCA3 immunofluorescence colocalization staining and quantitation in lung tissues from patients with IPF and healthy controls (× 400, n = 6). ( *P < 0.05, * *P < 0.01, ***P < 0.001, ns P > 0.05)

Article Snippet: HDAC3 flox/− mice were purchased from Shanghai Model Organisms Center, inc. (Shanghai, China).

Techniques: Expressing, Staining, Immunohistochemistry, Western Blot, Activity Assay, Immunofluorescence, Quantitation Assay

Journal: Clinical Epigenetics

Article Title: Histone deacetylase 3 deletion in alveolar type 2 epithelial cells prevents bleomycin-induced pulmonary fibrosis

doi: 10.1186/s13148-023-01588-5

Figure Lengend Snippet: HDAC3 is upregulated in lung tissues and AT2 cells from mice with BLM-induced pulmonary fibrosis. A Histological analyses of H&E staining, masson staining, PSR staining and Ashcroft score for fibrosis in BLM-treated mice at day 0, 7, 14 and 21 post-treatment (× 200, n = 5). B Relative mRNA expression of HDAC3, Col 1 and α-SMA in lung tissues from BLM-treated mice at day 0, 7, 14 and 21 (n = 5). C Representative Western blot images and corresponding quantitative results for HDAC3, Col 1 and α-SMA in lung tissues from BLM-treated mice at day 0, 7, 14 and 21 (n = 5). D HDAC3 activity in lung tissues from saline and BLM-treated mice (2.5 mg/kg for 21d; n = 5). E Representative images showing HDAC3 and ABCA3 immunofluorescence colocalization staining and quantitation in lung tissues from BLM-treated mice at day 21 (× 400, n = 5). ( *P < 0.05, * *P < 0.01, ***P < 0.001, ns P > 0.05)

Article Snippet: HDAC3 flox/− mice were purchased from Shanghai Model Organisms Center, inc. (Shanghai, China).

Techniques: Staining, Expressing, Western Blot, Activity Assay, Saline, Immunofluorescence, Quantitation Assay

Journal: Clinical Epigenetics

Article Title: Histone deacetylase 3 deletion in alveolar type 2 epithelial cells prevents bleomycin-induced pulmonary fibrosis

doi: 10.1186/s13148-023-01588-5

Figure Lengend Snippet: TGF-β1/SMAD3 signaling upregulates HDAC3 transcription. A Representative images showing immunohistochemical staining of TGF-β1 in saline-treated and BLM-treated mice at day 21. (× 200, n = 5). B The relative mRNA level of TGF-β1 in lung tissues from BLM-treated mice at day 21. (n = 5). C The relative mRNA level of HDAC3 in TGF-β1-treated primary mouse AT2 cells at 0, 24, 48, 72 h. (n = 5). D Representative images of HDAC3 immunofluorescence staining and quantitation in AT2 cells after TGF-β1 stimulation at 72 h. (× 1000, n = 5). E HDAC3 activity in AT2 cells after PBS or TGF-β1 treatment (10 ng/ml for 72 h). (n = 5). F Representative Western blot images and the corresponding quantitative results for HDAC3, phosphorylated-SMAD3 (p-SMAD3) and SMAD3 in TGF-β1-treated primary mouse AT2 cells at 0, 24, 48, 72 h. (n = 5). G , H mRNA and protein expression of HDAC3 after SB431542 inhibited TGF-βRI in AT2 in the presence of DMSO or TGF-β1 for 72 h. (n = 5) (SB431542 was administered half an hour before TGF-β1 or DMSO). I , J The mRNA and protein level of HDAC3 after SIS3 inhibited the phosphorylation of SMAD3 in AT2 in the presence of DMSO or TGF-β1 for 72 h. (n = 5; SIS3 was administered half an hour before TGF-β1 or DMSO). K Chromatin immunoprecipitation assay showing SMAD3 and the HDAC3 promoter with or without SMAD3 overexpression in AT2 cells. (n = 5). L Quantitation of HDAC3 via luciferase assay. AT2 cells were transfected with the normal murine HDAC3 promoter reporter plasmid (CAGCGAGCCCAGACATCTCGCTTGA) and mutant HDAC3 promoter reporter plasmid (CAGCGAGCCCAGCACTCTCGCTTGA) as a negative control plus a renilla luciferase plasmid. Then, AT2 cells were treated with TGF-β1 (10 ng/ml) and/or SIS3 (10 μM) for 72 h and luciferase activities measured and normalized with renilla luciferase activities(n = 5). ( *P < 0.05, * *P < 0.01, ***P < 0.001, ns P > 0.05)

Article Snippet: HDAC3 flox/− mice were purchased from Shanghai Model Organisms Center, inc. (Shanghai, China).

Techniques: Immunohistochemistry, Staining, Saline, Immunofluorescence, Quantitation Assay, Activity Assay, Western Blot, Expressing, Chromatin Immunoprecipitation, Over Expression, Luciferase, Transfection, Plasmid Preparation, Mutagenesis, Negative Control

Journal: Clinical Epigenetics

Article Title: Histone deacetylase 3 deletion in alveolar type 2 epithelial cells prevents bleomycin-induced pulmonary fibrosis

doi: 10.1186/s13148-023-01588-5

Figure Lengend Snippet: HDAC3 deficiency in AT2 cells alleviates pulmonary fibrosis in vivo and in vitro through suppression of EMT . A Histological analyses showing H&E staining, masson staining, PSR staining and Ashcroft score for fibrosis of BLM-treated mice at day 21 in HDAC3-C and HDAC3-CKO mice. (× 200, n = 5). B The relative mRNA expression of Col 1, α-SMA, E-cadherin, N-cadherin and vimentin in HDAC3-C and HDAC3-CKO mice in the presence of saline or BLM for 21d. (n = 5). C Representative Western blot images and the corresponding quantitative results for E-cadherin, N-cadherin and vimentin in HDAC3-C and HDAC3-CKO mice in the presence of saline or BLM for 21d. (n = 5). D The relative mRNA expression of E-cadherin, N-cadherin and vimentin in PBS-treated or TGF-β1 treated primary AT2 cells from HDAC3-C and HDAC3-CKO mice for 72 h. (n = 5). E Representative Western blot images and the corresponding quantitative results for E-cadherin, N-cadherin and vimentin in HDAC3-C and HDAC3-CKO mice in PBS-treated or TGF-β1 treated primary AT2 cells from HDAC3-C and HDAC3-CKO mice for 72 h. (n = 5). ( *P < 0.05, * *P < 0.01, ***P < 0.001, ns P > 0.05)

Article Snippet: HDAC3 flox/− mice were purchased from Shanghai Model Organisms Center, inc. (Shanghai, China).

Techniques: In Vivo, In Vitro, Staining, Mouse Assay, Expressing, Saline, Western Blot

Journal: Clinical Epigenetics

Article Title: Histone deacetylase 3 deletion in alveolar type 2 epithelial cells prevents bleomycin-induced pulmonary fibrosis

doi: 10.1186/s13148-023-01588-5

Figure Lengend Snippet: Genetic deletion or pharmacological inhibition of HDAC3 promotes the acetylation and degradation of GATA3. A Representative Western blot images and the corresponding quantitative results of KLF4, HIF-α, GATA3, c-Jun and BRD4 in PBS-treated or TGF-β1 treated primary AT2 cells from HDAC3-C and HDAC3-CKO mice for 72 h. (n = 5). B The relative mRNA expression of GATA3 in PBS-treated or TGF-β1 treated primary AT2 cells from HDAC3-C and HDAC3-CKO mice for 72 h. (n = 5). C , D Protein degradation assay. Representative Western blot images and corresponding quantitative results for GATA3 in AT2 cells following treatment with cycloheximide (250 μg/ml) for 0, 1, 2, 4, 6, 8 h after genetic (HDAC3 deficiency in AT2) or pharmacological (RGFP966, 15 μM) inhibition of HDAC3. (n = 3). E The acetylation level of GATA3 in AT2 was determined by Co-IP experiments after genetic (HDAC3 deficiency in AT2) or pharmacological (RGFP966 for 4 h, 15 μM) inhibition of HDAC3. (n = 5). ( *P < 0.05, * *P < 0.01, ***P < 0.001, ns P > 0.05. M refers to protein marker)

Article Snippet: HDAC3 flox/− mice were purchased from Shanghai Model Organisms Center, inc. (Shanghai, China).

Techniques: Inhibition, Western Blot, Expressing, Degradation Assay, Co-Immunoprecipitation Assay, Marker

Journal: Clinical Epigenetics

Article Title: Histone deacetylase 3 deletion in alveolar type 2 epithelial cells prevents bleomycin-induced pulmonary fibrosis

doi: 10.1186/s13148-023-01588-5

Figure Lengend Snippet: TGF-β1/SMAD3/HDAC3 mediated EMT is partially dependent on GATA3. A GATA3 protein quantification following knockdown by si-GATA3. (n = 5). B Representative Western blot images and the corresponding quantitative results of E-cadherin, N-cadherin, vimentin, HDAC3, p-SMAD3 and SMAD3 in PBS-treated or TGF-β1 treated primary AT2 cells for 72 h after GATA3 was knocked down or not. (n = 5). C Relative mRNA expression of HDAC3, E-cadherin, N-cadherin and vimentin. (n = 5). ( *P < 0.05, * *P < 0.01, ***P < 0.001, ns P > 0.05)

Article Snippet: HDAC3 flox/− mice were purchased from Shanghai Model Organisms Center, inc. (Shanghai, China).

Techniques: Western Blot, Expressing

Journal: Clinical Epigenetics

Article Title: Histone deacetylase 3 deletion in alveolar type 2 epithelial cells prevents bleomycin-induced pulmonary fibrosis

doi: 10.1186/s13148-023-01588-5

Figure Lengend Snippet: The selective HDAC3 inhibitor, RGFP966, alleviated BLM-induced pulmonary fibrosis and EMT in vivo . A Schematic diagram of RGFP966 intervention. Histological analyses using H&E staining, masson staining, PSR staining and Ashcroft score for fibrosis in saline-treated and BLM-treated mice at day 21 after RGFP966 was administered intraperitoneally. (× 200, n = 5). B Representative images of E-cadherin and vimentin immunofluorescence staining and quantitation in lung tissues from saline-treated and BLM-treated mice at day 21 after RGFP966 was administered intraperitoneally. (× 400, n = 5). C , D The relative mRNA and protein level of Col 1, α-SMA, E-cadherin, N-cadherin, vimentin and GATA3 in lung tissues from saline-treated and BLM-treated mice at day 21 after RGFP966 was administered intraperitoneally. (n = 5). ( *P < 0.05, * *P < 0.01, ***P < 0.001, ns P > 0.05)

Article Snippet: HDAC3 flox/− mice were purchased from Shanghai Model Organisms Center, inc. (Shanghai, China).

Techniques: In Vivo, Staining, Saline, Immunofluorescence, Quantitation Assay

Journal: Clinical Epigenetics

Article Title: Histone deacetylase 3 deletion in alveolar type 2 epithelial cells prevents bleomycin-induced pulmonary fibrosis

doi: 10.1186/s13148-023-01588-5

Figure Lengend Snippet: Schematic illustration of the mechanisms of HDAC3 in AT2 cells. TGF-β1 expression is upregulated in pulmonary fibrosis and phosphorylates SMAD3 through the TGF-βRI receptor. Activated SMAD3 directly binds to the promoter of HDAC3 to increase its transcription. HDAC3 further decreases the acetylation of GATA3 and inhibits its degradation, which promotes the epithelial-mesenchymal transition of AT2 cells by decreasing E-cadherin expression and increasing expression of N-cadherin and vimentin, which aggravates pulmonary fibrosis

Article Snippet: HDAC3 flox/− mice were purchased from Shanghai Model Organisms Center, inc. (Shanghai, China).

Techniques: Expressing

Journal: Clinical Epigenetics

Article Title: Histone deacetylase 3 deletion in alveolar type 2 epithelial cells prevents bleomycin-induced pulmonary fibrosis

doi: 10.1186/s13148-023-01588-5

Figure Lengend Snippet: The primers used in real-time PCR

Article Snippet: HDAC3 flox/− mice were purchased from Shanghai Model Organisms Center, inc. (Shanghai, China).

Techniques:

Journal: Nature Communications

Article Title: HDAC3 maintains oocyte meiosis arrest by repressing amphiregulin expression before the LH surge

doi: 10.1038/s41467-019-13671-8

Figure Lengend Snippet: a HDAC3 (green) levels in GCs decreased dramatically in response to hCG stimulation. Nuclei were dyed with Hoechst (blue). Scale bar = 100 µm. n = 3 biologically independent experiments. b HDAC3 protein levels were upregulated by PMSG and downregulated by hCG in a time-dependent manner. P48: 48 h after PMSG treatment, equivalent to 48 h after the FSH surge. H1–H4: 1–4 h after hCG treatment, equivalent to 1–4 h after the LH surge. n = 3 biologically independent experiments. Data are presented as mean ± SEM, and different letters (a–d) indicate significant differences among groups (two-sided ANOVA test), P (a, b) < 0.05, P (a, c) < 0.01, P (a, d) < 0.01, P (b, c) < 0.001, P (b, d) < 0.01, P (c, d) < 0.05. c Hdac3 knockout efficiency was examined and quantified by western blotting analysis. n = 3 biologically independent experiments. Data are presented as mean ± SEM. Asterisks (*) indicate significant differences at *** P = 0.00007 determined by the two-sided t test. d HDAC3 (green) immunostaining in the different mouse models revealed oocyte maturation independent of LH in follicles lacking Hdac3 expression ( Hdac3 - ) in GCs, whereas oocytes in Hdac3 -positive ( Hdac3 + ) follicles remained in the GV stage, similar to the situation in Hdac3 flox/flox mice. Scale bar = 100 µm. Nuclear DNA in indicated in blue (Hoechst). e Oocyte maturation (GVBD) rates in follicles with or without HDAC3 expression in the different mouse genotypes. Source data are provided as a Source Data file.

Article Snippet: Hdac3 flox/flox mice were purchased from the Jackson Laboratory (ME, USA), and Foxl2 - Cre ER T2 mice were a gift from Dr. Liu Kui.

Techniques: Knock-Out, Western Blot, Immunostaining, Expressing

Journal: Nature Communications

Article Title: HDAC3 maintains oocyte meiosis arrest by repressing amphiregulin expression before the LH surge

doi: 10.1038/s41467-019-13671-8

Figure Lengend Snippet: a Quantitative real-time PCR revealed Areg expression in Hdac3 flox/flox and Hdac3 cKO GCs after PMSG treatment. Data are presented as mean ± SEM. Asterisks (*) indicate significant differences at *** P = 0.000003 determined by the two-sided t test. b AREG levels in Hdac3 flox/flox and Hdac3 cKO GCs were quantified by western blotting analysis. n = 3 biologically independent experiments. Data are presented as mean ± SEM. Asterisks (*) indicate significant differences at *** P = 0.0009 determined by the two-sided t test. c Quantitative real-time PCR showed that inhibiting HDAC3 increased Areg expression in GCs in vitro. HDACi 4b, an HDAC3 inhibitor. Data are presented as mean ± SEM. Asterisks (*) indicate significant differences at *** P = 5.15E−5 determined by the two-sided t test. d AREG levels in control and HDACi 4b-treated GCs were quantified by western blotting analysis. n = 3 biologically independent experiments. Data are presented as mean ± SEM. Asterisks (*) indicate significant differences at *** P = 3.27E−5 determined by the two-sided t test. e Representative images demonstrate the effect of GC-derived HDAC3 on cumulus cell expansion within in vitro cultured COCs. Scale bar = 100 µm. n = 3 biologically independent experiments. f Oocyte maturation (GVBD) rates were significantly improved by HDACi 4b, and this effect was reversed by AG1478. AG1478, EGFR inhibitor. n = 3 biologically independent experiments. Data are presented as mean ± SEM, and different letters (a–c) indicate significant differences among groups (two-sided ANOVA and Holm–Šidák test), P (a, b) < 0.001, P (a, c) < 0.05, P (b, c) < 0.001. g ChIP-qPCR analysis of HDAC3 at the Areg promoter (−343 to −150) before and after the LH surge. n = 3 biologically independent experiments. Data are presented as mean ± SEM, and different letters (a–b) indicate significant differences among groups (two-sided ANOVA and Holm–Šidák test), P (a, b) < 0.001. h HDACi 4b was unable to rescue 8-Br-cGMP-mediated inhibition of oocyte maturation (GVBD). Data are presented as mean ± SEM, and different letters (a–b) indicate significant differences among groups (two-sided ANOVA and Holm–Šidák test), P (a, b) < 0.001. i HDACi 4b had no direct effect on denuded oocyte meiotic maturation. j Scatter plot comparison of oocyte transcripts between the control and HDAC3 inhibitor groups revealed that HDACi 4b had no effect on oocyte developmental competence. Pearson statistical test used for statistical analysis . k Volcano plot of transcriptomic analysis of GCs isolated from Hdac3 flox/flox and Hdac3 cKO ovaries. Source data are provided as a Source Data file.

Article Snippet: Hdac3 flox/flox mice were purchased from the Jackson Laboratory (ME, USA), and Foxl2 - Cre ER T2 mice were a gift from Dr. Liu Kui.

Techniques: Real-time Polymerase Chain Reaction, Expressing, Western Blot, In Vitro, Control, Derivative Assay, Cell Culture, ChIP-qPCR, Inhibition, Comparison, Isolation

Journal: Nature Communications

Article Title: HDAC3 maintains oocyte meiosis arrest by repressing amphiregulin expression before the LH surge

doi: 10.1038/s41467-019-13671-8

Figure Lengend Snippet: a H3K14ac levels were increased by hCG in a time-dependent manner. n = 3 biologically independent experiments. Data are presented as mean ± SEM, and different letters (a–d) indicate significant differences among groups (two-sided ANOVA and Holm–Šidák test), P (a, b) < 0.01, P (a, c) < 0.01, P (a, d) < 0.001, P (b, c) < 0.05, P (b, d) < 0.01, P (c, d) < 0.05. b Immunostaining revealed that LH increased H3K14ac (green) levels in GCs in vivo. Nuclei were dyed with Hoechst (blue). Scale bar = 100 µm. n = 3 biologically independent experiments. c ChIP-qPCR analysis of H3K14ac at the Areg promoter (−343 to −150) before and after the LH surge. P48: 48 h after PMSG treatment. H1–H4: 1–4 h after hCG treatment. Data are presented as mean ± SEM, and different letters (a–c) indicate significant differences among groups (two-sided ANOVA and Holm–Šidák test), P (a, b) < 0.01, P (a, c) < 0.001, P (b, c) < 0.001. d H3K14ac levels in Hdac3 flox/flox and Hdac3 cKO GCs were quantified by western blotting analysis. n = 3 biologically independent experiments. Data are presented as mean ± SEM. Asterisks (*) indicate significant differences at *** P < 0.001 determined by the two-sided t test. e ChIP-qPCR analysis of H3K14ac at the Areg promoter in Hdac3 flox/flox and Hdac3 cKO GCs. Data are presented as mean ± SEM, and different letters (a–c) indicate significant differences among groups (two-sided ANOVA and Holm–Šidák test), P (a, b) < 0.001, P (a, c) < 0.001, P (b, c) < 0.05. f Western blotting analysis showed that HDACi 4b (HDAC3 inhibitor) substantially increased H3K14ac levels. n = 3 biologically independent experiments. Data are presented as mean ± SEM. Asterisks (*) indicate significant differences at *** P < 0.001 determined by the two-sided t test. g ChIP-qPCR analysis of H3K14ac at the Areg promoter in control and HDACi 4b-treated GCs. Data are presented as mean ± SEM, and different letters (a–c) indicate significant differences among groups (two-sided ANOVA and Holm–Šidák test), P (a, b) < 0.001, P (a, c) < 0.001, P (b, c) < 0.001. Source data are provided as a Source Data file.

Article Snippet: Hdac3 flox/flox mice were purchased from the Jackson Laboratory (ME, USA), and Foxl2 - Cre ER T2 mice were a gift from Dr. Liu Kui.

Techniques: Immunostaining, In Vivo, ChIP-qPCR, Western Blot, Control

Journal: Nature Communications

Article Title: HDAC3 maintains oocyte meiosis arrest by repressing amphiregulin expression before the LH surge

doi: 10.1038/s41467-019-13671-8

Figure Lengend Snippet: a Venn diagram of HDAC3 partners between the HDAC3-IP group and the negative IgG group revealed that HDAC3 could interact with the core members of the NCoR complex. b Venn diagram of potential transcription factors that bind the Areg promoter between the DNA pulldown data and JASPAR data. Among these transcription factors, FOXO1, GATA4, and Myod1 (green), but not SP1 (yellow), were identified as HDAC3 interactors. c Cross-linking Co-IP coupled with western blotting analysis of HDAC3 showed the captured HDAC3 complexes at the chromatin. n = 3 biologically independent experiments. d Reverse cross-linking Co-IP coupled with western blotting analysis of HDAC3 demonstrated the interaction between HDAC3 and FOXO1. n = 3 biologically independent experiments. Source data are provided as a Source Data file.

Article Snippet: Hdac3 flox/flox mice were purchased from the Jackson Laboratory (ME, USA), and Foxl2 - Cre ER T2 mice were a gift from Dr. Liu Kui.

Techniques: Co-Immunoprecipitation Assay, Western Blot

Journal: Nature Communications

Article Title: HDAC3 maintains oocyte meiosis arrest by repressing amphiregulin expression before the LH surge

doi: 10.1038/s41467-019-13671-8

Figure Lengend Snippet: a Inhibition of SP1 reversed the HDACi 4b-mediated induction of Areg expression. MIT, SP1 inhibitor. Data are presented as mean ± SEM, and different letters (a–b) indicate significant differences among groups (two-sided ANOVA and Holm–Šidák test), P (a, b) < 0.001. b Western blotting analysis revealed that inhibition of HDAC3 did not affect SP1 expression. HDACi 4b, HDAC3 inhibitor. n = 3 biologically independent experiments. Data are presented as mean ± SEM. c ChIP-qPCR analysis of SP1 at the Areg promoter (−343 to −150) in control and HDACi 4b-treated GCs. Data are presented as mean ± SEM, and different letters (a–c) indicate significant differences among groups (two-sided ANOVA and Holm–Šidák test), P (a, b) < 0.05, P (a, c) < 0.001, P (b, c) < 0.001. d SP1 levels in Hdac3 flox/flox and Hdac3 cKO GCs were quantified by western blotting analysis. n = 3 biologically independent experiments. Data are presented as mean ± SEM. Asterisks (*) indicate significant differences at *** P < 0.001 determined by the two-sided t test. e ChIP-qPCR analysis of SP1 at the Areg promoter in Hdac3 flox/flox and Hdac3 cKO GCs. Data are presented as mean ± SEM, and different letters (a–c) indicate significant differences among groups (two-sided ANOVA and Holm–Šidák test), P (a, b) < 0.05, P (a, c) < 0.001, P (b, c) < 0.001. f Inhibition of SP1 reversed the LH-mediated induction of Areg expression. Data are presented as mean ± SEM, and different letters (a–c) indicate significant differences among groups (two-sided ANOVA and Holm–Šidák test), P (a, b) < 0.001, P (a, c) < 0.001, P (b, c) < 0.001. g Western blotting analysis revealed that LH did not affect the SP1 expression in vivo. n = 3 biologically independent experiments. Data are presented as mean ± SEM. h ChIP-qPCR analysis of SP1 at the Areg promoter before and after the LH surge. P48: 48 h after PMSG treatment. H1–H4: 1–4 h after hCG treatment. Data are presented as mean ± SEM, and different letters (a–c) indicate significant differences among groups (two-sided ANOVA and Holm–Šidák test), P (a, b) < 0.05, P (a, c) < 0.001, P (b, c) < 0.001. Source data are provided as a Source Data file.

Article Snippet: Hdac3 flox/flox mice were purchased from the Jackson Laboratory (ME, USA), and Foxl2 - Cre ER T2 mice were a gift from Dr. Liu Kui.

Techniques: Inhibition, Expressing, Western Blot, ChIP-qPCR, Control, In Vivo

Journal: Nature Communications

Article Title: HDAC3 maintains oocyte meiosis arrest by repressing amphiregulin expression before the LH surge

doi: 10.1038/s41467-019-13671-8

Figure Lengend Snippet: a The GVBD ratios were similar in the control and HDACi 4b groups. HDACi 4b, HDAC3 inhibitor. b More MII-stage oocytes were present in the HDACi 4b group than in the control group. Data are presented as mean ± SEM. Asterisks (*) indicate significant differences at *** P = 0.0002 determined by the two-sided t test. c The blastocyst rate of all GV stage oocytes was considerably increased in the HDACi 4b group compared with the control group. Data are presented as mean ± SEM. Asterisks (*) indicate significant differences at *** P = 0.0006 determined by the two-sided t test. d Representative images show blastocysts obtained from the control and HDACi 4b groups. Scale bars = 100 µm and 40 µm (enlarged). n = 3 biologically independent experiments. e , f Blastocysts from the control and HDACi 4b groups were transferred into surrogate mice. e Birth rates of the control and HDACi 4b groups. f Representative images depicting the pups born in the control and HDACi 4b groups. g The birth weights of the pups in the control and HDACi 4b groups were similar. The data are presented as the mean ± SEM. Source data are provided as a Source Data file.

Article Snippet: Hdac3 flox/flox mice were purchased from the Jackson Laboratory (ME, USA), and Foxl2 - Cre ER T2 mice were a gift from Dr. Liu Kui.

Techniques: Control